Transcription
qPCR QuantificationProtocol GuideFOR RESEARCH USE ONLYTopicsILLUMINA PROPRIETARYCatalog # SY-930-1010Part # 11322363 Rev. ASeptember 20093Introduction5User-Supplied Consumables and Equipment7Select Control Template8Dilute qPCR Control Template9Dilute Libraries10Prepare Reaction Mix11Aliquot to 96-Well Plate12Quantify by qPCR13Analyze15Appendix A - Determine Cluster Numbers for Control Library17Appendix B - Sample Preparation for Cluster Generation19Appendix C - Determine Relative GC Content of Library
This document and its contents are proprietary to Illumina, Inc. and its affiliates(“Illumina”), and are intended solely for the contractual use of its customers and for noother purpose than to use the product described herein. This document and its contentsshall not be used or distributed for any other purpose and/or otherwise communicated,disclosed, or reproduced in any way whatsoever without the prior written consent ofIllumina, Inc.For the proper use of this product and/or all parts thereof, the instructions in thisdocument must be strictly and explicitly followed by experienced personnel. All of thecontents of this document must be fully read and understood prior to using the product orany of the parts thereof.FAILURE TO COMPLETELY READ AND FULLY UNDERSTAND AND FOLLOW ALL OF THECONTENTS OF THIS DOCUMENT PRIOR TO USING THIS PRODUCT, OR PARTSTHEREOF, MAY RESULT IN DAMAGE TO THE PRODUCT, OR PARTS THEREOF, ANDINJURY TO ANY PERSONS USING THE SAME.RESTRICTIONS AND LIMITATION OF LIABILITYThis document is provided “as is,” and Illumina assumes no responsibility for anytypographical, technical or other inaccuracies in this document. Illumina reserves the rightto periodically change information that is contained in this document and to make changesto the products, processes, or parts thereof described herein without notice.Illumina does not assume any liability arising out of the application or the use of anyproducts, component parts, or software described herein. Illumina does not convey anylicense under its patent, trademark, copyright, or common-law rights nor the similar rightsof others. Illumina further reserves the right to make any changes in any processes,products, or parts thereof, described herein without notice. While every effort has beenmade to make this document as complete and accurate as possible as of the publicationdate, no warranty of fitness is implied, nor does Illumina accept any liability for damagesresulting from the information contained in this document.ILLUMINA MAKES NO REPRESENTATIONS, WARRANTIES, CONDITIONS, ORCOVENANTS, EITHER EXPRESS OR IMPLIED (INCLUDING WITHOUT LIMITATION ANYEXPRESS OR IMPLIED WARRANTIES OR CONDITIONS OF FITNESS FOR A PARTICULARPURPOSE, NON-INFRINGEMENT, MERCHANTABILITY, DURABILITY, TITLE, OR RELATEDTO THE PERFORMANCE OR NONPERFORMANCE OF ANY PRODUCT REFERENCEDHEREIN OR PERFORMANCE OF ANY SERVICES REFERENCED HEREIN).This document may contain references to third-party sources of information, hardware orsoftware, products or services, and/or third-party web sites (collectively the “Third-PartyInformation”). Illumina does not control and is not responsible for any Third-PartyInformation, including, without limitation, the content, accuracy, copyright compliance,compatibility, performance, trustworthiness, legality, decency, links, or any other aspect ofThird-Party Information. Reference to or inclusion of Third-Party Information in thisdocument does not imply endorsement by Illumina of the Third-Party Information or of thethird party in any way. 2009 Illumina, Inc. All rights reserved.Illumina, illuminaDx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate,GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress,VeraCode, IntelliHyb, iSelect, CSPro, and GenomeStudio are registered trademarks ortrademarks of Illumina, Inc. All other brands and names contained herein are the propertyof their respective owners.
3IntroductionThis document describes a qPCR method for quantifying libraries generatedusing the Illumina sample preparation protocols. qPCR is a method ofquantifying DNA based on PCR. qPCR tracks target concentration as afunction of PCR cycle number in order to derive a quantitative estimate of theinitial template concentration in a sample. As with conventional PCR, it uses apolymerase, dNTPs, and two primers designed to match sequences within atemplate.For the purposes of this protocol, the primers match sequences within theadapters flanking an Illumina sequencing library. qPCR is, therefore, an idealmethod for measuring libraries in advance of generating clusters, because itwill only measure templates that have both adaptor sequences on either endwhich will subsequently form clusters on a flowcell. Moreover, qPCR is a verysensitive method of measuring DNA and thus dilute libraries withconcentrations below the threshold of detection of conventionalspectrophotometric methods are amenable to quantification by qPCR.ScopeThere are several different qPCR instruments available from instrumentvendors, each with its own proprietary software for running experiments andanalyzing data. It is beyond the scope of this document to describe protocolsfor all instruments and analysis packages. Instead, this document describes aprotocol designed around a Stratagene Mx3000P qPCR machine andStratagene MxPro software. You will need to adapt this protocol to yourspecific qPCR platform.QuantificationWorkflowFigure 1 illustrates the qPCR quantification workflow. Dilute the controltemplate and the libraries for quantification to the pM range and run qPCR.From the qPCR results, calculate the concentration of the quantified librariesand dilute them to a standard concentration (e.g., 2 nM).qPCR Quantification Protocol Guide
4 Control TemplateLibraries forquantificationDilute control template andlibraries for quantificationto pM rangeRun qPCR and generate CtvaluesxCtxxPlot standard curve andread off concentrations ofquantified librariesLog initial ConcentrationFigure 1qPCR Quantification WorkflowNOTEDuring qPCR setup, it is important to avoid DNA crosscontamination. Clean the set up area, including allequipment to be used, thoroughly with 0.5% sodiumhypochlorite (10% bleach). Illumina also recommends usinga dedicated set of pipettes for qPCR to minimizecontamination.NOTEThe accuracy of qPCR is highly dependent on accuratepipetting and thorough mixing of solutions. Take extra careto avoid pipetting errors during qPCR set up and whenpreparing templates for clustering.Catalog # SY-930-1010Part # 11322363 Rev. A
5User-Supplied Consumables and EquipmentCheck to ensure that you have all of the necessary user-suppliedconsumables and equipment before proceeding.Table 1User-Supplied ConsumablesConsumableSupplier0.1N NaOHGeneral lab supplier0.5% sodium hypochlorite (10% bleach)General lab supplier0.1% Tween 20General lab supplier96-well platesStratagene, part # 410088Control template (10 nM)General lab supplierHybridization bufferIllumina, part # 1000166KAPA SYBR FAST Master Mix Universal 2XqPCR Master Mix (2 x 5 ml 10 ml)Kapa Biosystems, part #KK4602Libraries to be quantified diluted to approximately 10 nM General lab supplierOptical strip capsStratagene, part # 401425Pipettes(P2, P10, P200, P1000, andan 8 channel multichannel dispensing 18 μl)General lab supplierQIAGEN EB 250 ml elution bufferQIAGEN, part # 19086qPCR primer 1.1:5' AATGATACGGCGACCACCGAGAT 3' HPLC purifiedGeneral lab supplierqPCR primer 2.1:5' CAAGCAGAAGACGGCATACGA 3' HPLC purifiedGeneral lab supplierOne or more of the following kits in order to correspondto the number of libraries to be quantified:a. Single-Read Cluster Generation Kit (1 flow cell)b.Single-Read Cluster Generation Kit (10 flow cells)c. Paired-End Cluster Generation Kit (1 flow cell)d.Paired-End Cluster Generation Kit (5 flow cells)qPCR Quantification Protocol Guidea. Illumina, part # GD-1003-4001b.Illumina, part # GD-1003-4010c. Illumina, part # PE-2003-4001d.Illumina, part # PE-2003-4005
6Table 2Equipment ChecklistEquipmentSuggested SupplierBenchtop centrifuge with swing out rotorSorvall Legend RTBenchtop microcentrifugeGeneral lab supplierGenome AnalyzerIllumina, part # SY-301-1301qPCR machineStratagene Mx3000PVortexerGeneral lab supplierCatalog # SY-930-1010Part # 11322363 Rev. A
7Select Control TemplateBefore starting qPCR, select the control template against which the librariesfor quantification can be measured.In principle, any library prepared for sequencing on the Illumina platform canbe used as a control for qPCR and you may wish to tailor a control templateto suit your specific needs. The control template should be as similar aspossible in terms of template size, GC content and library type(e.g., genomic, CHIP-seq, etc.) to the libraries for quantification. It is alsoimportant to note that the control template needs to be available in sufficientquantity, as specified in this protocol, for it to be used in multiple qPCRreactions.In order to correlate library concentration with cluster number, it isrecommended to generate a titration flowcell for the control template (seeAppendix A - Determine Cluster Numbers for Control Library and AppendixB - Sample Preparation for Cluster Generation).The GC content of a given library is not always known and this poses aproblem for matching the library to an appropriate control template for qPCRquantification. However, it is possible to estimate the GC content of Illuminalibraries relative to other Illumina libraries of the same template size byperforming a limited number of cycles of qPCR followed by a dissociationcurve. The higher the GC content of the library, the higher the meltingtemperature of the PCR product (see Appendix C - Determine Relative GCContent of Library). Once the GC content of a library is known, anappropriate control template can be selected for qPCR quantification.qPCR Quantification Protocol Guide
8Dilute qPCR Control TemplateUse the appropriate control library for the libraries you wish to quantify.NOTEConsumablesIllumina recommends using a control library that gives agood range of cluster numbers when clustered between2–20 pM. qPCR control template (10 nM)NOTEStore the qPCR 10 nM library template in small aliquots toavoid multiple freeze and thaw cycles. 0.1% Tween 20 stored at room temperature(e.g., 50 ml water 50 μl Tween 20)Procedure1. Add 198 μl of the 0.1% Tween 20 to 2 μl of the qPCR control template tomake a 100-fold dilution.2. Vortex the dilution to thoroughly mix the samples.3. Add 100 μl of the 0.1% Tween 20 to 100 μl of the diluted template tomake a titration curve of six 2x serial dilutions. This will give 7 controltemplate dilutions in the range of 100–1.6 pM.NOTEIt is important to make fresh dilutions of the qPCR controltemplate immediately before qPCR as the DNA does notstore well at low concentrations.4. Vortex the dilution to thoroughly mix the samples.5. Repeat steps 1 through 4 to produce 3 independent serial dilutions ofthe control template.NOTEControl dilutions are diluted a further 10X into the finalSYBR mix, so the final concentration in the qPCR is10–0.16 pM.Catalog # SY-930-1010Part # 11322363 Rev. A
9Dilute LibrariesThe libraries for quantification need to be diluted to the same range as thecontrol template for qPCR. Libraries for quantification diluted to approximately 10 nM in QIAGENConsumablesEB BufferNOTEIt is important to make fresh dilutions of the qPCR unknownlibrary template before qPCR as the DNA does not storewell at low concentrations. 0.1% Tween 20 stored at room temperature(e.g., 50 ml water 50 μl Tween 20)Procedure1. Add 998 μl of the 0.1% Tween 20 to 2 μl of the unknown library templateto make a 500-fold dilution. This will give an approximate concentrationof 20 pM.2. Vortex the dilution to thoroughly mix the samples.3. Repeat steps 1 and 2 to produce 3 independent dilutions of the librarytemplate. Triplicate results for qPCR are important for subsequentanalysis.NOTEqPCR Quantification Protocol GuideUnknown sample dilutions are diluted a further 10X into thefinal SYBR mix so the final concentration in the qPCR isapproximately 2 pM.
10Prepare Reaction MixIt is important to make a master mix to minimize pipetting errors. Themethod here makes enough master mix to fill a 96-well plate, but it ispossible to make less master mix if you do not wish to use all 96 wells.ConsumablesProcedure KAPA SYBR FAST Master Mix Universal (2x)qPCR primer 1.1qPCR primer 2.1Water1. Prepare the SYBR master mix reaction mix as follows:Consumableμl/well μl/plate (master mix for 110)KAPA SYBR FAST Master Mix Universal (2x) 101100qPCR Primer 1.1 (10 μM)0.222qPCR Primer 2.1 (10 μM)0.222Water7.68361819802. Mix gently but thoroughly.3. Place the reaction mix on ice and protect it from light until use.Catalog # SY-930-1010Part # 11322363 Rev. A
11Aliquot to 96-Well PlateThe next step in the process is to aliquot the control template dilutions,unknown library dilutions, and master mix. It is important during this step topipette as accurately as possible, because small variations in volumes willgreatly affect the qPCR results. ConsumablesProcedureControl template dilutions (see Dilute qPCR Control Template)Libraries for quantification dilutions (see Dilute Libraries)Reaction Mix (see Prepare Reaction Mix)96-well platesOptical strip caps1. Add 2 μl of the control template dilutions, the unknown library dilutions,or water to each well in a 96-well plate. Take care to pipette accuratelyinto the wells as small variations will affect the assay. For example, the96-well plate can be filled as follows:123456789101112AControl Control Control Sample Sample Sample Sample Sample Sample Sample Sample SampleBControl Control Control Sample Sample Sample Sample Sample Sample Sample Sample SampleCControl Control Control Sample Sample Sample Sample Sample Sample Sample Sample SampleDControl Control Control Sample Sample Sample Sample Sample Sample Sample Sample M 12.5pM 17181920555131313212121666141414222222Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample1.56pM 1.56pM 1.56pMH321Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample3.13pM 3.13pM 3.13pMG21Control Control Control Sample Sample Sample Sample Sample Sample Sample Sample Sample6.25pM 6.25pM 6.25pMF1NTCNTCNTC78Figure 277151515232323Sample Sample Sample Sample Sample Sample Sample Sample Sample88161616242424Well Plate FormatWells in columns 1–3 contain the control template dilutions and the notemplate control (NTC) in triplicate. Wells in columns 4–12 contain thesample dilutions in triplicate.2. Dispense 18 μl of the master mix into each well of the 96-well platesusing a multichannel pipette. Take care to pipette accurately into thewells as variations in volume will affect the assay. Change tips for eachnew column.3. Place the optical strip lids on the wells, taking care to avoid crosscontamination and to avoid smudging the surface of the lids.4. Centrifuge the 96-well plate to 280 xg for 1 minute.qPCR Quantification Protocol Guide
12Quantify by qPCRQuantify the libraries by qPCR.Procedure1. Place the 96-well plate in the qPCR machine in the correct orientationand clean the optical lids with lens tissue to remove any dust beforeclosing the qPCR machine lid.2. Use the following thermal profile:ProcedureTemperatureTimeHot start95ºC3 minutes95ºC3 seconds60ºC30 secondsX 40Catalog # SY-930-1010Part # 11322363 Rev. A
13AnalyzeThe final step in the qPCR procedure is to analyze the quantified libraries.Procedure1. Check the NTC wells for any amplification. There should be noamplification, but data is acceptable if any amplification is 10 cyclesafter your last control template amplification.2. Ensure that there is good amplification for the control template andremove any bad replicates (Figure 3).Figure 3Example of Control Template Amplification3. Generate a standard curve from the control template by plotting the Ctvalues against the log initial concentration (Figure 4).qPCR Quantification Protocol Guide
14Log Fit ValuesSYBR Standards, RSq:0.998SYBR, Y -3.31*LOG(X) 14.21, Eff. 100.4%Figure 4Example of Standard Curve4. Ensure that the efficiency of amplification of the control template is90–110% (a slope of -3.58 to -3.10) and that the R2 0.9. If not, reassessthe datapoints you are using to calculate the standard curve.5. Lock the threshold fluorescence based on the standard curve.6. Ensure that there is good amplification for the unknown library templatesand remove any bad replicates.7. Calculate the initial concentration of your unknown library templatesbased on the standard curve generated from the control templatedilutions.NOTERemember to factor in the 5000-fold dilution of unknownsample.8. Dilute the quantified library to a standard concentration for clustering. Asuggested protocol for preparing sample DNA for cluster generation isgiven in Appendix B - Sample Preparation for Cluster Generation onpage 17.Catalog # SY-930-1010Part # 11322363 Rev. A
15Appendix A - Determine Cluster Numbers for ControlLibraryA titration flowcell can be generated by preparing serial dilutions of templatehyb from the control library and counting the number of clusters followingthe sequencing cycles.NOTEThe number of cycles required depends on the Pipelineused. Perform the same number of cycles as the Pipeline,plus 1 cycle, required for phasing.It is necessary to perform multiple cycles of sequencing to achieve anaccurate cluster count, since the Pipeline analysis uses the cycles to identifyindividual clusters in a full length sequencing run.Cluster counts from a first cycle report are not accurate, particularly at highcluster density, due to the different way in which the clusters are counted. Acluster titration for the control template should be linear up until the point atwhich the clusters become too dense to count accurately, based on currentversion of the Illumina Genome Analyzer (GA) being used. An example of alibrary titration is shown in Figure 5. Consumables andEquipmentProcedureControl librarySequencing reagents (enough for the required number of cycles)Single-Read or Paired-End Cluster Generation KitGAII qPCR v#.xml1. Prepare serial dilutions of the template hyb from the control library andcluster on a flowcell.NOTEThe number of clusters required from the libraries to bequantified by qPCR should fall within the range of thetitration flowcell.2. Perform the sequencing cycles to count the clusters on the titrationflowcell. Ensure that there is enough reagent for the run, with a minimumof the following per cycle. These can be left over reagents. 1 ml of incorporation mix 0.5 ml of cleavage mix 2.5 ml of scanning mixFor GAII, use the recipe GAII qPCR v#.xml. This recipe will scan 9 tiles/columns.3. There is no need to change any configuration file on the instrument. Theoffsets may not be recalculated and the defaμlt offsets.txt file usedmight be the one generated during the previous run analysis. To avoidany confusion, make sure that the run name states the name of the GA(e.g. 080908 eas139 0051 FC30BKFAAXX).qPCR Quantification Protocol Guide
164. Use the following settings for the Pipeline analysis:USE BASES YY. ANALYSIS sequence.5. Plot the cluster numbers displayed in the summary table against theinitial concentration of control template.6. Calculate the pM concentration required for the desired number ofclusters using the equation of the line.Figure 5Example of Library TitrationIn Figure 5, an E. coli control library with a template size of 300 bp wasclustered on four flowcells at 16 pM, 8 pM, 4 pM, 2 pM, 1 pM, 0.5 pM,and 0.25 pM and clusters were counted through the Pipeline followingfive cycles of sequencing.Catalog # SY-930-1010Part # 11322363 Rev. A
17Appendix B - Sample Preparation for Cluster GenerationIndependently of DNA quantification, it is important to be able to achieveprecise cluster numbers (i.e., a given library clustered at the sameconcentration should always give the same number of clusters). However, it isoften observed that the same library clustered on separate occasions cangive different cluster numbers and this can be attributed to the smallpipetting volumes and large number of pipetting steps involved in thecurrent cluster protocol. Illumina recommends a modified protocol forclustering to achieve more consistent cluster numbers when the same librarywill be used on multiple flow cells or lanes. DNA Library QIAGEN EB Buffer 0.1% Tween 20 (QIAGEN EB Tween)Consumables andEquipment(e.g., 50 ml QIAGEN EB 50 μl Tween) 0.1N NaOHHybridization BufferVortexerBenchtop MicrocentrifugePipettes(P2, P10, P200, P1000, and an 8 channel multichannel dispensing 18 μl)NOTEProcedureTo minimize errors in preparing 0.1N NaOH fresh each day,prepare it in large batches and aliquot it into 50 ml sealedtubes. These aliquots may be stored up to 6 months at2 to 8 C and used in the protocol as needed. Once youopen an aliquot, use it on the same day that it was opened.Discard any reagent that is left at the end of the day.1. Dilute the DNA library templates to 2 nM based on qPCR quantificationin QIAGEN EB Tween using a minimum volume of 10 μl using aP10 pipette.2. Denature 10 μl of 2 nM template DNA by adding 10 μl 0.1N NaOH togenerate 20 μl of a 1 nM denatured template using a P10 pipette tomake the dilutions.3. Vortex the template solution.4. Centrifuge the template solution to 280 xg for 1 minute.5. Incubate for 5 minutes at room temperature to denature the templateinto single strands.6. Add 980 μl of pre-chilled hybridization buffer using a P1000 pipette tothe tube containing the denatured template solution to generate a20 pM template hyb solution.qPCR Quantification Protocol Guide
187. Vortex the template hyb.NOTEYou may aliquot into smaller volumes to avoid multiplefreeze/thaws. If so, the volumes should be large(e.g., 250 μl) to enable accurate pipetting for furtherdilutions.The 20 pM template hyb solution can be diluted using large volumepipetting to the correct concentration for clustering, as judged from theqPCR control template titration flowcell. Any remaining 20 pM templatehyb can be stored at -15º to -25ºC for up to 3 weeks.Storage of the 20 pM template hyb solution enables you to re-use thesame template hyb with the possibility of clustering at a different concentration at a later time. By storing the 20 pM template hyb you do nothave to begin the cluster process again from the 2 nM stock, thus preventing any further cluster number variability. Since the libraries arequantified by qPCR before clustering it is assumed that a concentrationabove 20 pM would not be required.Catalog # SY-930-1010Part # 11322363 Rev. A
19Appendix C - Determine Relative GC Content of LibraryThe GC content of a library is not always known, but it is possible to estimatethe GC content of Illumina libraries relative to other Illumina libraries of thesame size by performing a dissociation curve on the qPCR instrument. Thehigher the GC content of the library then the higher the melting temperature.Therefore, libraries of the same template length can be directly comparedand GC content of unknown libraries estimated relative to libraries of knownGC content (Figure 6).Plasmodium falciporum (20% GC)Human (40% GC)E. coli (50% GC)TB (65% GC)Figure 6Example of Dissociation Curves Generated for 300 bp Illumina LibrariesConsumables andEquipmentqPCR Quantification Protocol Guide Illumina libraries of known GC content ( 10 nM)Illumina libraries of unknown GC content ( 10 nM)KAPA SYBR FAST Master Mix Universal 2xqPCR machine96-well platesOptical strip capsBenchtop centrifuge with swing out rotor
20Procedure1. Prepare the following reaction mix for each library (including controls) ina 96-well plate/reactionConsumableμl/reactionKAPA SYBR FAST Master Mix Universal (2x)10qPCR Primer 1.1 (10 μM)0.2qPCR Primer 2.1 (10 μM)0.2Water7.6Illumina library (approx 10 nM)2202. Put the optical strip lids on the wells and briefly spin the 96-well platedown in a bench top centrifuge to 280 xg for 1 minute.3. Place the 96-well plate in the qPCR machine in the correct orientationand clean the optical lids with lens tissue to remove any dust beforeclosing the qPCR machine lid.4. Use the following thermal profile:ProcedureTemperatureTimeHot start95ºC3 minutes95ºC3 seconds60ºC30 secondsX 105. At the end of the thermal profile ramp slowly from 60º to 95ºC togenerate a dissociation curve.Catalog # SY-930-1010Part # 11322363 Rev. A
Illumina, Inc.9885 Towne Centre DriveSan Diego, CA 92121-1975 1.800.809.ILMN (4566) 1.858.202.4566 (outside North America)[email protected]
(e.g., 50 ml water 50 μl Tween 20) Procedure 1. Add 198 μl of the 0.1% Tween 20 to 2 μl of the qPCR control template to make a 100-fold dilution. 2. Vortex the dilution to thoroughly mix the samples. 3. Add 100 μl of the 0.1% Tween 20 to 100 μl of the diluted template to make a titrati
